In a wider population, cytomegalovirus infection can cause pathological changes in organs and tissues of the whole body, causing serious damage to fetuses and infants, and even death, which may be related to the incidence of malignant tumors such as cervical cancer. So it is very important to know that CMV actively prevents cytomegalovirus infection.
[pathology]
pathogen
The virus in saliva belongs to herpesvirus subfamily, which is a virus, human herpesvirus group. It consists of linear double-stranded DNA with molecular weight of about 150X 106. Its largest is an icosahedron composed of 162 shell particles (virus shell particles). Typical herpes virus structure. The forms of herpes simplex virus and varicella zoster virus are very similar and difficult to distinguish.
CMV can only proliferate in human fibroblasts cultured in tissue, but not in other animal cells, and the proliferation rate is very slow, with a replication cycle of 36-48 hours, which is 8 hours longer than that of herpes virus. It takes more than a month for the initial separation of special cells, and the cells become the expansion of the park, a huge cell and nucleus, and the "halo" of the nucleus surrounds the large eosinophilic inclusions. The target cells in organisms are epithelial cells. Extensive cross-reaction among various human cytomegalovirus strains. about
CMV survived for 2 hours in 20% ether. PH < 5, or standing at 56℃ for 30 minutes, or ultraviolet irradiation for 5 minutes is enough to inactivate. Cytomegalovirus infection is resistant to freeze-thaw, or unstable at -20℃ or -50℃. 10% household bleach can significantly reduce its infection. about
CMV infection is characterized by typical cytoplasmic and nuclear inclusions, also known as giant cells of cytomegalovirus. Mast cells in human tissues cause giant cell inclusion disease.
Cytomegalovirus (CMV) is the main infection in the pathogenesis, which exists in the host cell indefinitely in a latent state. It is suggested that the lungs, liver, pancreas, salivary glands, central nervous system and intestine may also be various tissues and organs involved in the latent sites of the virus. The severity of congenital infection is related to the lack of precipitated antibodies and the ability of T cells to respond to cytomegalovirus. Cytomegalovirus infection in peripheral blood of children and adults inhibits the phenotype of activated cytotoxic T lymphocytes. If the function of host T cells is impaired, latent virus may revive and lead to various syndromes. Chronic disease stimulation caused by cytomegalovirus activation in tissue transplantation. Some powerful T-cell immunosuppressants, such as antithymocyte globulin, are the high incidence period of clinical CMV syndrome. In addition, CMV can be used as a functional cofactor to activate latent HIV infection.
Infected patients of acute infectious diseases and their sources of infection. It has been found in blood, saliva, tears, urine, semen, feces, cervical and vaginal secretions, milk and other cytomegaloviruses. The spread of milk, saliva and urine can last for weeks to years.
susceptible population
Cytomegalovirus is widespread all over the world, and people have a wide range of susceptibility. Humans are the only host of cytomegalovirus.
Serological survey: seasonal trend of 40- 100% adult cytomegalovirus antibody epidemic.
Different countries and different economic conditions have different infection rates. In Asia and Africa, 90% of people are infected, most of them are young, and the antibody and infection age are earlier, while the infection in western countries occurs in the later stage. The survey also shows that economic income groups and low-income groups have higher infection rates. In this 70-year-old population, the antibody positive rate is over 20 years old. Women tend to occur in men aged 20-30 and men aged 50-60. After the age of 35, the positive rate of antibody between men and women is basically the same. Although the body has produced circulating antibodies, the virus can still be eliminated continuously or intermittently, thus causing chronic or recessive infection.
Most people will be infected with cytomegalovirus all their lives, but the main infection is asymptomatic recessive infection. Adult cytomegalovirus infection is closely related to immune function. Viruses often last a lifetime and exist in the form of latent infection. Only when the host's immune state is unbalanced, such as organ and bone marrow transplantation, cancer, mathematics, pregnancy and the application of immunosuppressants, can latent viruses be revived. The revival of latent viruses and asymptomatic carriers may lead to the spread of viruses. Due to organ transplantation and immunosuppressive therapy, the incidence of latent virus infection or immune activation latent virus and cytomegalovirus in AIDS patients is often high.
Transmission route of cytomegalovirus:
(1) Congenital infection: during pregnancy (intrauterine infection), cytomegalovirus can be transmitted to the fetus through the placenta.
(2) Acquired infection (perinatal infection): During delivery, the virus in cervical secretion can be transmitted to the newborn through the birth canal.
(3) The virus secreted by postpartum milk can be directly transmitted to the baby through breastfeeding.
(4) Long-term contact, detoxification, saliva, urine and tears can spread.
(5) Homologous CMV infection can be transmitted through blood transfusion and organ transplantation. Homologous cytomegalovirus infection is a serious blood transfusion and organ transplantation. Multiple blood transfusions or massive blood transfusions increase the risk of primary and recurrent infection, and the risk of cytomegalovirus infection after organ or bone marrow transplantation is also high. Sexually Transmitted
(6): Because viruses often exist in urogenital secretions, semen or cervical secretions can be directly transmitted through sexual intercourse.
Due to the infection of semen, cervical secretions, tears and feces (oral libido, anal kiss). Cytomegalovirus Infection Pathway (Central) Table 1
Mother's influence on fetus, newborn, children and adults
contact transmission
(saliva, urine)
transfuse blood
hepatitis
Respiratory tract infection recessive infection
hepatitis
respiratory tract infection
& gt
→ Children with poor maturity gain weight, pneumonia caused by slow immunosuppressants and
Gastrointestinal mucosa
Hepatitis viremia
┌→ Non-invasive
│BR/>； └→ Infection → Urine sugar positive healthy newborn infectious mononucleosis infectious mononucleosis virus
Infectious mononucleosis-like diseases → polycythemia in viral urine and abnormal liver function.
Instantaneous platelet/> reduces latent infection of blood transfusion.
Unknown fever and asymptomatic infection.
→ Systemic giant cell inclusion body disease
↓
Or signs of mental retardation.
[Journal of Immunology]
Cytomegalovirus infection can cause the decline of immune function, especially cellular immune function. CMV infection significantly affects the functions of thymus and spleen cells, mononuclear phagocytes, NK cells and CTL cells.
In the laboratory, newborn guinea pigs with acute CMV infection in thymus and spleen were inhibited, and the number of thymus and T cells in adult mice decreased, and 88% thymic cytomegalovirus was detected.
Cytomegalovirus infection affects spleen function, and the proliferation activity of spleen lymphocytes decreases. ConA stimulated spleen cells to produce IL-2, which decreased significantly.
Immunosuppression caused by & ltBr cytomegalovirus infection is related to the replication of intracellular virus. The characteristic of CMV replication is that mononuclear phagocytes and cytomegalovirus infected cells are most likely to have important regulatory and effector functions of mononuclear phagocytes, T cells, B cells and lymphocytes in some unidentified monocytes. Cytomegalovirus infection can damage the immune function of many lymphocytes. about
Acute mononucleosis caused by cytomegalovirus infection. The mitotic proliferation of peripheral blood lymphocytes, the weakening of cytomegalovirus antigen and HSV antigen, induced the increase of interferon level, and the CD4/CD8 ratio decreased to1.7 0.70.2+0.2, which decreased the activity of T cells. After changing some long-lasting diseases, 10 months, the proportion of T cell subsets in most patients has not completely returned to normal.
Immunosuppression of cytomegalovirus infection is caused by infection of large monocytes with virus and dysfunction of CD8 cells. Monocyte phagocytes play an important role in anti-CMV immunity, which can not only directly phagocytize and prevent viruses, but also deal with immune response, secretion, regulation and amplification of current antigens and cytokines. When CMV is infected, the function of mononuclear phagocytes is affected, the phagocytosis of macrophages caused by cytomegalovirus infection reduces the changes of intracellular oxygen free radicals, FC receptors and complement receptors, and the low-grade agricultural products with antigen presentation function, IL- 1, also reduce the IL- 1 and IL-2 reactions. Moses et al. measured the proliferation of thymocytes, the activity of IL- 1 decreased, and the decrease of IL- 1 production could lead to the imbalance of TH/TS cells.
Antagonistic effect of cytomegalovirus diffusion on NK cells. NK cells actively participate in the whole process of anti-cytomegalovirus infection. NK activity is high, but there is not necessarily a protective reaction, but there is evidence of active infection. NK cells can not prevent the occurrence of primary cytomegalovirus infection, but once NK cells are infected, the early stage of cytomegalovirus infection will limit the spread and infection. NK cells and CTL cells are important effector cells against CMV. In the early stage of CMV replication, before infectious virions are produced, they can cut infected cells and make the virus abort and spread between cells. In the mouse model, the virus acted for 3-5 days, and the antiviral effect mediated by NK cells was enhanced by IFN. 6-2 1 day, cytotoxic CTL of spleen and peripheral blood cells. The activity of NK cells and CTL cells determines the sensitivity of cytomegalovirus infection, and the body is easy to recover after infection. The activity of cytomegalovirus infected cells, NK cells and CTL cells was also seriously affected. In addition, specific cellular immunity can prevent the recurrence of CMV infection. It is to detect the occurrence of T cell reactions in renal transplant recipients infected by cytomegalovirus. It is found that 14 cytomegalovirus has 20 cytotoxic reactions, and 6 cytotoxic reactions have serious clinical consequences. Therefore, the existence of specific T cells can prevent the recurrence of CMV infection.
The body reduces the virulence of cytomegalovirus infection, which may be the antibody of various antibodies. Milk, cervical secretions, saliva, although specific antibodies, including neutralizing antibodies. However, cytomegalovirus antibodies can still be detected, which can not stop the spread of the virus. Antibodies passively acquired by intrauterine fetus from mother, infected birth canal or milk cannot be stopped. Studies have shown that intraperitoneal or intravenous injection of 0.2 ml of high titer anti-CMV globulin in mice can completely protect animals from death before the fatal CMV attack. CMV, etc. And then the second attack, all animals are still alive, indicating that antibodies can reduce the toxicity of cytomegalovirus.
What happens when pregnant women are infected with cytomegalovirus?
Pregnant women infected with cytomegalovirus can infect the fetus through the placenta, causing congenital infection, abortion and stillbirth.
Infants with congenital infection may have no symptoms, but some serious cases may involve multiple organs and even lead to death. Symptoms can be manifested as hepatosplenomegaly, jaundice, petechiae or idiopathic thrombocytopenic purpura, chorioretinitis and microcephaly. All children will have hearing loss, vision loss, confusion, dyskinesia and mental retardation to varying degrees. Infection through birth canal or breast-feeding after birth is acquired infection, with mild symptoms, good prognosis, abnormal liver function and personal.
[Clinical manifestations]
What are the symptoms of cytomegalovirus infection?
Most healthy adults have no obvious clinical symptoms of cytomegalovirus infection, and some patients may have symptoms such as infectious mononucleosis, fever, fatigue, sore throat, lymphadenopathy, muscle pain, polyneuritis, peripheral blood lymphocytes and splenomegaly.
Fetal intrauterine infection during pregnancy is prone to spontaneous abortion and may damage stillbirth or premature delivery. Neonatal symptoms can be seen as hepatosplenomegaly, jaundice, hepatitis, thrombocytopenic purpura, hemolytic anemia, nervous system degeneration, microcephaly, mental retardation, visual and hearing impairment.
Neonatal infection can have no systemic symptoms, some only show respiratory symptoms, and some have abnormal liver function. No nerve damage.
The natural history of cytomegalovirus infection is very complicated. After the primary infection is detoxified, it often takes weeks, months or even years before the potential infection. Frequent repeated infections, detoxification. Even if the latent virus is reactivated many years after the initial infection, virus strains with different antigenicity may appear when it is reinfected. The clinical manifestations of cytomegalovirus infection are related to the immune function and age of the individual. As shown in Table 2, the symptoms and signs of iatrogenic infection are varied, whether from vertical transmission, parallel transmission or iatrogenic infection.
Table 2CMV Clinical course of infectious diseases and disease types (Belrocher)
Severe types: jaundice, anemia, hepatosplenomegaly, thrombocytopenia, neonatal infection (congenital)
Purpura reduction, central nervous system invasion, pneumonia, myocarditis)
B mild type: suspended animation, cardiac hypertrophy and hyperbilirubinemia.
2。 CMV reinfection in asymptomatic period after birth and lactation (congenital/acquired? )
A. Whole body
Type B and C respiratory system (whooping cough-like) hepatosplenomegaly
. Gastrointestinal type
Kidney type?
3。 Acquired type
One. influenza A virus
B. Types of mononucleosis
breathing pattern
D. Gastrointestinal hepatitis E
F. due to the low ability of special medical defense.
Dick. Asymptomatic?
4. 1, 2,3 About the long-term consequences of cytomegalovirus infection, it is common to have clinical histiocytosis after transfusion of monocytes, due to immune dysfunction, mental retardation and bradykinesia.
Vascular, retinal inflammation, pneumonia and gastrointestinal infection. Most patients with guillain-barre syndrome.
[diagnosis]
If the clinical manifestations of cytomegalovirus infection cannot be diagnosed, it is necessary to isolate a virus from clinical samples by laboratory reference (or the specific antibody is increased by more than 4 times or the antibody titer is continuously increased) to be diagnosed.
Virus isolation method
Inoculate the best saliva, urine, reproductive tract secretions, milk and white blood cells into human fibroblasts for reproduction and separation. Cytopathic effects (giant cell fixation and HE staining, which CPE can observe) appear for several days or weeks. Nuclear inclusion, perinuclear halo and eosinophil cytoplasmic inclusion, much like "owl eye" (owl eye), can also be examined by monoclonal or polyclonal antibody staining.
The two most commonly used methods are serum complement antibody detection.
Comprehensive test (CF), indirect immunofluorescence (IIF), immunoenzyme test (EIA), indirect hemagglutination test (IHA) and radioimmunoassay (RIA). When a single serum sample is taken to determine the history of cytomegalovirus infection, the serum sample should be taken immediately at intervals of 2 weeks, 4 weeks and 8 weeks, and then the serum sample separated from the virus can be used for the diagnosis of primary infection.
DNA probe
The 32P labeled probe of CMV has been widely used, and some samples, mixing is a more sensitive method than virus isolation, which is used for the most sensitive detection.
Polymerase chain reaction
(1) specimen collection and processing
Collect samples, including blood, urine and glandular tissue of patients. The buffy coat prepared from whole blood can be stored at -80℃. Urine samples can be stored in liquid nitrogen. Frozen specimens should avoid repeated freezing and thawing.
The urine sample was centrifuged at 2500 rpm for 65438 00 minutes to remove cell debris and collect supernatant. The pretreated urine contains PCR inhibitors, such as the required polyethylene glycol (PEG 6000): 50? L urine supernatant and 50? 20% peg 6000 and 25 l? L-2 mol/L NaCl, mixed and placed in an ice bath for 6 hours; Centrifuge at the speed of 15000 rpm for 30 minutes, and collect the precipitate. Centrifuge at 6400 rpm for 3 minutes; Remove the supernatant by suction as much as possible and suspend the precipitate in distilled water. The suspension can be directly used for PCR amplification, and the amplification product should be heated at 100℃ for 10 min and cooled in a rapid ice bath.
(b) the prepared template DNA
1。 Preparation of template DNA from blood sample
A: add NaCl to make the final concentration of glucose in serum1.50 mmol/l; 10? L serum was amplified by direct PCR at 70℃ for 45 seconds.
Method B: The prepared buffy coat (BCP): (1) BCP, and the precipitate was collected and washed twice with PBS. 2 add 500? ? Homogenate of 6mol/L guanidine hydrochloride. ③ Add 30? ? 10 mmol/l EDTA, 10 mmol/l NaCl, 30? L20%% sodium dodecyl sarcosine and 5? ,? Protease K( 10mg/ml), mixed and reacted at 60℃1h. ④ Add 1 130? L ethanol precipitation 65438 0 hours, -20℃. ⑤ Centrifuge and collect the precipitated DNA. ⑥ Wash with 70% ethanol twice, and finally suspend the precipitate in 10 mmol/L Tris-HCl and 1mmol/L EDTA. 4℃ for standby.
2。 Template DNA:① Used for the preparation of frozen tissue specimens: ① Does the cryostat cut 5 to 10? Place the frozen tissue block in a 1.5ml plastic tube. (2) Add 10% formalin solution to the prepared buffer. ③ 10/0min 1? 2 minutes, gently pour out the supernatant, centrifuge, precipitate with ethanol, and wash twice. ④ room temperature 10 drying? 60 minutes ⑤ Add extraction buffer (100mmol/L Tris- hydrochloric acid, 4 mmol/L EDTA, 8.0400g/mL protease K), thus mashing the just submerged precipitate (about 50 to 100 L). Formalin fixation, paraffin embedded tissue dewaxing and drying, please click here. ⑥ Put it in a liquid at 37℃. ⑦ Put it into boiling water for 7 minutes to inactivate protease K⑧ Centrifuge and collect supernatant, and take 1? 10? L can be amplified by PCR.
3。 Template DNA for urine sample preparation: ①100? L urine supernatant contains 100? L 6 mol/L guanidine isothiocyanate, 7? L 2mol/L NaCl and 20? L glass powder suspension (DNA preparation, Asahi glass company, Tokyo, Japan). (2) Stir at room temperature for 65438 00 minutes, centrifuge at 6400 rpm for 2 minutes, and collect the precipitate. ③ Wash the precipitate once with 50% ethanol, 10 mmol/L Tris-HCl and 50mmol/l NaCl with pH 7.4, and centrifuge at 6400r/min 1 min. (4) Wash the same sediment twice with water and collect the sediment. ⑤ Add 50? Distilled water at 55℃ for 65438 05 minutes. ⑥ 15000 r/min centrifuge for 2 minutes, collect supernatant (containing cytomegalovirus DNA), perform PCR amplification, then heat the suspension at 100℃ for 10 minute, and cool it quickly in ice bath. about
(III) Primers and probes
Primers and probes were designed based on the sequences of four exons in the promoter region of cytomegalovirus immediate early protein gene, the sequences of late antigen gp64 gene and phosphorylated protein pp7 1 gene. Table 3 lists the primers and probes commonly used in.
(4)PCR amplification step
1. 10× reaction buffer: 100 mmol/L Tris- hydrochloric acid, KCl with pH of 8.4, 500 mmol/L, 25 mmol/L magnesium chloride, 2 mg/ml gelatin.
Taq DNA polymerase: 5U/? length
10×dNTP concentration: the concentration of each of the four dNTPs is 2.0 mmol/L.
Primer: 100pmol/L
2。 Conventional PCR amplification
10× reaction buffer reaction mixture (50 liters)? large
10×dNTP？ ?
Template DNA of 5? rise
Taq DNA polymerase 0.2? L (international unit)
0.5 per primer? rise
Distilled water 3.8? rise
Add 1? Two drops of mineral oil.
The reaction mixture was heated to 94.d egree. C. for 5 minutes, and then heated to 72.d egree. C. for 60 seconds within 40 seconds at 95.d egree. C. and 55.d egree. C. for 35 to 40 amplification cycles.
Table 3 Primers and probes for CMV PCR amplification
primer
survey
Sequence (5'→3') position
chippy
size
IE 1 CCACCCGTGGTGCCAGCTCC
Early gene
159(BP)
IE2
CCCGCTCCTCCTGAGCACCC
IE3 (probe)
ctggtgtcacccccagagtcccctgtacccgcgacttcc
LA 1
CCGCAACCTGGTGCCCATGG
Late GP64 139
LA2 CGTTTGGGTTGCGCAGCGGG
LA3 (probe)
Ttcttctgggacgccacacacatccatcttcgccgg exon1/>; 139
IE 1b
GGAATCCGCGTTCCAATGCA
IE 1a
AGATCGCCTGGAGACGCCAT
(early) morning
/& gt； IE2a
ATGGAGTCCTCTGCCAAGAG
Early exon 2
Seventy two
IE2b
CCGTGGCACCTTGGAGGAAG
IE3a
& gtGTGACCAAGGCCACGACGTT
Exon in early March
167
IE3b
tctgccagaggacatctttctc
IE4a
ACAGATTAAGGTTCGAGTGC
Exon in early April
179
IE4b
CAATACACTTCATCTCCTCG
IE4c
TTACCAAGAACTCAGCCTTC
Exon 4 of early gene
& gt 158
IE4d
gtgcgtgagccaccttgtctc
IE4e tatacccagacggaagaagaaaattca
Exon 4 of early gene
426
IE4f
ATAAGCCATAATCTCATCAGGGGAG
PP 1A
Tagcgcgcatacatccgtacat & ltbr/pp71gene
3 16
Pp 1b
ATGACGTTGCTCCGTGGAAAGAGACC
Pp7 1
3。 Nested PCR amplification: ① The same component (2) in the reaction mixture, only primers IE2a and IE4b (including 72 1B of exon 3), each 100pmol. At 94℃ for 60 seconds, 150 seconds and 52℃ for 72℃ for 480 seconds, the amplification was carried out for 20 cycles. ② Take 2? For the amplification product of L, IE3a and IE3b of 100pmol were added to each primer. Then 20 cycles of amplification were carried out at 94℃ for 60 seconds, 150 seconds and 52℃ for 72℃180 seconds.
(e) product identification
The products of amplification analysis can be solid phase hybridization and liquid phase hybridization test (membrane).
1。 Solid phase hybridization:
① Pre-hybridization solution was 3×SSPE, 5× Denhardt, 0.5%SDS and 25% formamide. The amplified product of the membrane was prehybridized at 42℃ for 30 minutes. 60 minutes ② Add labeled probe (10cpm/G, 2ng/ml) and mix for 30? 60 minutes ③ 0.2× sspe.0 1% SDS was washed at room temperature for 3 times, 5 minutes/time, 60℃, 10 minutes/time, and then washed at room temperature for more than 1 time, 5 minutes/time. ④ Autoradiography.
2。 Liquid phase hybridization and gel electrophoresis:
① take110 volume amplification product at 0.5? 1.0 pmol is mixed at the probe. (2) Adding EDTA solution with the final concentration of 150mmol/L of sodium chloride, sodium, phosphoric acid and glucose to make the total volume 20? ? ③ At 95℃ 10 min, and then at 56℃ for 60 min ... ④ Centrifuge the added sample buffer for 65,438+00 seconds and electrophoresis on 8% polyacrylamide gel. ⑤ After electrophoresis, ethidium bromide was stained, and then X-ray film was autoradiographed.
The base sequence of HCMV DNA molecule has not been found. Although the length of its DNA restriction endonuclease fragment is polymorphic, the discreteness in its genome is still unclear. It can be confirmed that 90% of wild-type strains of human cytomegalovirus can be amplified by PCR using a single primer pair. Almost all virus strains can be detected by using more than two groups of primers with different HCMV sequences. Therefore, in this case, the primers are located in two or more pairs in different regions of the genome by PCR.
In the preparation of HCMV template DNA, sometimes some small DNA fragments are produced, and PCR reaction often produces a certain degree of bottom products, which affects the determination results. In this case, nested PCR can be used, and its basic principle is that the amplification of target DNA is divided into two steps: first, the target DNA, including long DNA fragments, is amplified with a pair of primers, and then only a small amount of target DNA amplified by primers is amplified for the second time. By controlling each step, the number of false positive amplification cycles caused by small DNA fragments can be prevented. This method can also avoid false negative results.
It is highly sensitive to detect HCMV samples by PCR. It is equivalent to dozens of viral DNA molecules or 1? 5PFU can detect the DNA sequence of the virus in the supernatant of HCMV infected tissue culture. Southern hybridization analysis of the amplified products showed that the pghcvmv DNA sequence at 1 level could be detected in urine samples. Using this system, dot hybridization can only be detected in the viral genome of 4× 104 cells, which is 2× 103 times higher than that of non-radioactive oligonucleotide probes.
The clinical application value of PCR technology in detecting HCMV infection, because viral DNA in body fluids can be used as an early indicator of HCMV infection when preclinical symptoms or serological evidence of infection appear. HCMV infection spreads through placenta and birth canal infection, and the mortality rate of infected newborns is high. Therefore, early diagnosis and timely treatment by PCR, prenatal and postnatal care is also very important. This method can also be used to identify the relationship between HCMV and many seriously ill organ or tissue transplant donors. In addition, PCR can detect the stability index, but it also has semi-quantitative analysis, so it can be used as a means to evaluate various antiviral efficacy.
[therapy]
Primary cytomegalovirus infection is found in early pregnancy, and pregnancy is terminated as soon as possible. If there is infection in the third trimester, we should further check the fetal malformation and take corresponding treatment measures. Clinical symptoms of antiviral therapy or congenital cytomegalovirus disease. Such as cytarabine, sulfonamides, interferon, etc., but the effect remains to be further observed. about
For treating cytomegalovirus infection, it can be used in various antiviral preparations, such as GCV, anti-cytomegalovirus immunoglobulin preparation, interferon and transfer factor. However, these drugs will not fundamentally solve the problem, and they often rebound after stopping the drug. The latent virus of this virus can be used as one of the causes of AIDS, and scholars all over the world are committed to controlling its infection. American scholars have recently developed two kinds of live vaccines, and the effect is quite good after the first experiment. One is made of AD 169 virus strain, and the other is made of Zhen Zhen virus strain. These two virus strains have clearly demonstrated their anti-cytomegalovirus efficacy. After parenteral administration, the antibody of cytomegalovirus increased, thus enhancing the immune function of the body.
[prevention]
Cytomegalovirus is very harmful to human beings and should be actively prevented.
(1) Exercise fitness awareness. Improve immune function and disease resistance, especially the reproductive age of women, in order to reduce the serious harm of cytomegalovirus to the fetus.
(2) We need to protect patients who are pregnant or have chronic wasting diseases and low immune function, and keep them away from the source of infection.
(3) Pay attention to environmental sanitation and food hygiene.
(4) Breast milk cytomegalovirus positive is not suitable for breast feeding.
(5) immune prevention. Still in the process of research and exploration.
There are great differences in clinical symptoms, age, patients' physical condition and infection route.
continue ......
There is no effective treatment for cytomegalovirus infection at present.
Due to congenital cytomegalovirus infection and carcinogenesis, some scholars believe that vaccines can prevent CMV infection. Due to technical limitations, it cannot be cultivated, and it is economical and practical, and it is expensive to die. The effective application of CMV vaccine in town is named attenuated live vaccine.
References:
Do you know the culprit of latent cytomegalovirus infection? about
Human cytomegalovirus (CMV) is a double-stranded DNA virus and one of the largest animal viruses. People are only infected with human cytomegalovirus. Relatively weak, because the virulence of other viruses, human cytomegalovirus, generally does not invade human organs and tissues and is seriously damaged, but the integration of virus genes related to fertilized eggs may prevent or affect replication and